SciCombinator

Discover the most talked about and latest scientific content & concepts.

Journal: Zhonghua nei ke za zhi

0

Objective: To investigate the prognostic factors of late-onset severe pneumonia (LOSP) in patients who underwent allogeneic hematopoietic stem cell transplantation (allo-HSCT). Methods: From January 2009 to December 2015, 68 patients with LOSP after allo-HSCT at Peking University Institute of Hematology were enrolled. In this retrospective study, univariate and multivariate analysis were used to evaluate the prognostic factors for LOSP after allo-HSCT. Results: The median time from allo-HSCT to the development of LOSP was 213 (90-2 330) days. The overall survival rate was 42.6% (29/68). The median survival time from LOSP to death was 21 days. Early mortality was defined as death within 21 days after LOSP, as late death more than or equal to 21 days. The median oxygenation index was 199.15 (92.21-290.48) mmHg. LOSPs in thirty-two patients (36.8%) were caused by virus, bacteria, fungi or mixed pathogens. The median C-reactive protein (CRP) was 75.65 (0.94-451.00) mg/L. The median procalcitonin (PCT) was 0.66 (0.00-249.00) μg/L. The higher PCT value indicated an early higher mortality rate by the ROC curve (PCT: cut-off ≥0.94 μg/L). Furthermore, multivariate analysis suggested that PCT more than or equal to 0.94 μg/L was a risk factor for early death of LOSP (OR=5.77, 95%CI 1.66-20.11, P=0.006). LOSP occurred later or equal to 213 days after allo-HSCT was also a risk factor of early death in LOSP (OR=4.74, 95%CI 1.33-16.89, P=0.017). No previous history of chronic graft versus host disease (GVHD) (OR=4.50, 95%CI 1.58-12.83, P=0.005) and LOSP later or equal to 213 days (OR=4.40, 95%CI 1.61-11.99, P=0.004) were the risk factors of late death in LOSP. Conclusions: PCT more than or equal to 0.94 μg/L and LOSP later or equal to 213 days are the risk factors of early death in LOSP. No previous chronic GVHD and LOSP later or equal to 213 days are the risk factors of late death in LOSP.

Concepts: Epidemiology, Medical statistics, Demography, Median, Graft-versus-host disease, Multivariate statistics, Hematopoietic stem cell transplantation, Hematopoietic stem cell

0

Objective: To compare the clinical efficacy and safety of nilotinib and imatinib as frontline therapy in newly diagnosed patients with chronic myeloid leukemia in chronic phase(CML-CP). Methods: Until December 31st 2016, 18 patients using nilotinib and 83 using imatinib were recruited in our study. The efficacy and safety of two groups were evaluated. Results: A total of 101 patients with CML-CP included 18 receiving nilotinib and 83 imatinib. The optimal response rates at 3, 6, 12 and 18 months in nilotinib and imatinib group were 88.9% (16/18) vs 57.3% (47/82) (P=0.012), 82.4% (14/17) vs 55.7% (44/79) (P=0.041), 9/12 vs 63.9% (39/61) (P=0.460), 6/9 vs 68.9% (31/45) (P=0.896) respectively. The optimal response rates by 3 months in low sokal risk group on nilotinib and imatinib were 9/9 vs 76.5%(26/34) (P=0.107), in intermediate and high sokal risk group were 7/8 vs 45.2%(14/31) (P=0.032). At the end of follow-up, the rate of major molecular response (MMR) in nilotinib group was 72.2%, which was higher than 56.6% in imatinib group (P=0.021). The rate of complete cytogenetic response (CCyR) in nilotinib group was 100%, which was higher than 71.1% in imatinib group (P = 0.002). Progression free survival (PFS) rates in nilotinib and imatinib groups were 94.4% and 98.8% (P=0.019) respectively; whereas event free survival (EFS) rates were 88.9% and 48.2% (P=0.045). The incidence of drug related adverse reactions in nilotinib and imatinib was similar with only minor proportion of grade ¾ adverse reactions. Conclusions: Nilotinib achieves a deeper molecular response in a shorter time than imatinib in newly diagnosed patients with CML-CP, especially in patients with high risk outcome. Good safety is obtained in both groups so as to ensure a long-term administration and improving prognosis.

Concepts: Medical terms, Leukemia, Chronic myelogenous leukemia

0

Objective: To summarize and analyze the clinical features and etiologies in hospitalized patients with syndrome of inappropriate antidiuretics (SIAD) during the past 25 years. Methods: All data of 128 patients with SIAD admitted to Chinese PLA General Hospital since January 1991 to January 2016 were collected. SIAD was diagnosed based on the 1957 criterion. Results: (1) The most frequent causes of increased inappropriate secretion of vasopressin were malignant tumors, lung diseases (e. g. pneumonia), and central nervous system diseases, in which malignant tumors accounted for 38.28% of the SIAD. (2) During the past 25 years, the proportion of malignant diseases declined from 4/7 to 35.29%, while, the proportion of pulmonary infection increased from 1/7 to 35.29% (P<0.05). (3) The patients with malignant tumors had the lowest serum sodium and serum osmolality among all SIAD patients. (4) CT scan had a high diagnostic value for chest and brain detection. (5) Among three SIAD subjects with unknown reasons at onset, two were diagnosed with small cell lung cancer and one with gastric cancer during follow-up. Conclusion: The etiology of SIAD is complex and it could be attributed to multifarious etiological factors. Malignant tumors account for the largest proportion of all patients, and pulmonary infection was ranked in second place. Cautions on tumors have to be taken when serum sodium of a SIAD patient is below 118.1 mmol/L.

Concepts: Central nervous system, Nervous system, Cancer, Metastasis, Oncology, Lung cancer, Pneumonia, The Canon of Medicine

0

Objective: Waist-to-height ratio (WHtR), a measurement of the distribution of body fat, correlated with abdominal obesity indicating that it might be a better predictor of cardiovascular risk and metabolic disease. We, therefore, evaluated optimal WHtR cutoff points according to the risk of framingham risk score (FRS) and metabolic syndrome (MS) in Chinese. Methods: The subjects were from China National Diabetes and Metabolic Disorders Survey during 2007-2008. Receiver operating characteristic analysis was used to examine the optimal cutoff values of WHtR according to the risk of FRS and MS. Results: A total of 27 820 women and 18 419 men were included in the evaluation. The average age was (45.0±13.7) years. The proportions of FRS ≥10% and MS increased with WHtR both in men and women. The cutoff points of WHtR for the risk of FRS ≥10% and MS were 0.51, 0.52 in men, and 0.52, 0.53 in women, respectively. When FRS ≥10% and MS were taken into consideration with a certain weights, the pooled cutoffs of WHtR were 0.51 in men, and 0.53 in women, respectively. By using the similar method, the optimized cutoff points were 0.52, 0.51, 0.50 for men and 0.51, 0.53, 0.54 for women in age group 20-39, 40-59 and ≥60 years, respectively. Conclusions: The optimal cutoffs of WHtR are 0.51 in men, and 0.53 in women for FRS≥10% in combination with MS indicating that this WHtR cutoff points might be used as indexes to evaluate obesity and risk of obesity-related diseases.

Concepts: Metabolism, Nutrition, Diabetes mellitus, Obesity, Insulin resistance, Metabolic syndrome, Inborn error of metabolism, Cutoff

0

Objective: To investigate the perinatal outcome, risk factors and long-term outcome of pregnancy complicated with pulmonary arterial hypertension(PAH) and congenital heart diseases (CHD). Methods: Clinical data of 110 pregnant women who were diagnosed as PAH-CHD were retrospectively analyzed in the Department of Obstetrics and Gynecology and Surgical Intensive Care Unit at Beijing Anzhen Hospital from 2004 to 2013. The survival and treatment status were followed up. Results: 110 subjects consisted of 11 mild PAH, 33 moderate and 66 severe ones. The incidences of deterioration in New York Heart Association (NYHA) classes (≥2) during pregnancy, respiratory failure, pulmonary hypertension crisis and arrhythmia were 25.5% (28/110), 7.3% (8/110), 10.0% (11/110), 10.0% (11/110) respectively. Among them, the difference of deterioration in NYHA classes (≥2) during pregnancy among the three groups was statistically significant. A total of 8 (7.3%) maternal deaths occurred during hospitalization, all of whom were severe PAH cases. Multivariate analysis showed that pulmonary artery systolic pressure was a risk factor of perioperative death (OR=1.042, P=0.005). There were 55 cases (50.0%) of term delivery, and 35 cases (31.8%) of iatrogenic abortion. The proportion of term delivery in the severe PAH group was significantly lower. The proportion of iatrogenic abortion and small for gestational age infant (SGA) were higher in severe group. The incidence of neonatal malformations was 8.0% (6/75). The follow-up rate was 61.8% (63/102). Sudden death was reported in a parturient a few days after discharge. The remaining 62 patients survived during follow-up, while 53 patients (85.5%) were functional class (FC) Ⅰ-Ⅱ, 9 (14.5%) were FC Ⅲ-Ⅳ at follow-up. The cardiac function deterioration during pregnancy was not significantly correlated with long-term deterioration (P=0.767). Conclusions: Perinatal mortality and the incidence of maternal and fetal adverse events were high in pregnancy with PAH-CHD. Pulmonary artery systolic pressure is a major risk factor for perioperative mortality in pregnant women. PAH-CHD woman had good overall outcome after puerperium.

Concepts: Pregnancy, Childbirth, Fetus, Heart, Blood pressure, Obstetrics, Pulmonary artery, Gestational age

0

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95%CI 1.94 - 4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

Concepts: DNA, Male, Molecular biology, Adenosine triphosphate, Female, Gender, Sex, Uric acid

0

To retrospectively analyze the prognostic significance of plasma Epstein-Barr virus (EBV) DNA in 122 patients with diffuse large B cell lymphoma (DLBCL). Plasma EBV DNA positivity was related to advanced disease stage (P=0.030), B symptoms (P=0.004) and elevated serum lactic dehydrogenase (LDH) (P=0.001). Furthermore, univariate analysis indicated that plasma EBV DNA level was associated with worse overall survival (OS) (HR=0.223, 95%CI 0.096-0.518, P<0.001) and worse progression free survival (PFS) (HR=4.417, 95%CI 1.911-10.208, P<0.001), whereas multivariate analysis showed plasma EBV DNA as a probable independent prognostic factor of clinical outcome(HR=0.409, 95%CI 0.166-1.008, P=0.052).

Concepts: AIDS, Protein, Bacteria, Virus, Multivariate statistics, Lymphoma, Lactate dehydrogenase, Epstein-Barr virus

0

Ten patients diagnosed with multifocal motor neuropathy (MMN) were recruited in the Department of Neurology at Chinese PLA General Hospital from January 1, 2009 to August 31, 2015. The clinical and electrophysiological features were analyzed retrospectively. All patients complained of progressive asymmetric limb weakness, which was more severe in distal than in proximal. Five presented muscle atrophy. None had sensory disturbances. All suffered diminished or disappeared tendon reflex, whereas Babinski signs were negative. Multi-focal conduction block (CB) was confirmed by nerve conduction studies (NCS) in all patients and 7 showed spontaneous potentials in needle electrode electromyography. Abnormal sensory nerve conduction was seen in 3 patients. Laboratory test revealed anti-ganglioside GM1 antibody in cerebrospinal fluid (CSF) in 6 cases and elevated CSF protein in 7 cases. Limb weakness alleviated greatly in 9 cases after intravenous immunoglobulin (IVIg) treatment. But the other one reported poor response, who had long course of disease, serious limb weakness and obvious muscle atrophy. Motor nerve damage is the most important manifestation of MMN and sensory nerve damage may also appear. NCS is essential to the diagnosis of this disease, with CB as the characteristic electrophysiological feature. IVIg is an effective treatment.

Concepts: Nervous system, Antibody, Muscle, Neurology, Pain, Electromyography, Nerve, Nerve conduction study

0

To investigate the impact of goal directed analgesia on the outcome of patients with mechanical ventilation in intensive care unit.A total of 126 patients who needed mechanical ventilation were recruited.With a method of before and after paired comparison, they were divided into two group: (1) analgesia with empirical administration or control group; (2) goal directed analgesia based on critical-care pain observation tool (CPOT). Compared with the control group, after goal directed analgesia was applied, the consumption of midazolam significantly dropped from (368.47±27.41) mg to (151.27±29.31) mg(P<0.05), whereas the consumption of dexmedetomidine significantly increased from (623.62±20.91) μg to (812.34±22.57) μg(P<0.05). The median score of Richmond agitation-sedation scale increased from -3 to -1.The incidence of delirium significantly reduced from 23.81% to 17.46%(P<0.05). The mean ventilator duration was significantly shortened from (168.49±11.41) h to (142.38±13.24) h(P<0.05). ICU length of stay was significantly shortened from (23.64±9.26) d to (19.63±8.46) d(P<0.05). Due to the mild sedation, patients receiving goal directed analgesia report less delirium, less ventilation time and shorter ICU length of stay, suggesting that the general outcome is improved.

Concepts: Scientific control, Scientific method, Intensive care medicine, Mechanical ventilation, Observation, Arithmetic mean, Midazolam, Outcome

0

Multiple myeloma (MM) is a clonal plasma cell malignancy, mainly in elderly people and still incurable at present. In the ear of novel agents and sensitive laboratory exams, the diagnosis and treatment of MM have been significantly improved. Chinese MM guidelines for the diagnosis and treatment were updated every two years according to the progression of international and domestic research and clinical studies. In this version, we updated the response criteria and new combination regimens in newly diagnosed patients. Monoclonal gammopathy of renal significance (MGRS) was added as a new part of differential diagnosis, meanwhile, relapsed/refractory MM patients should be treated as long as possible.

Concepts: Multiple myeloma, Medical terms, Differential diagnosis, Monoclonal gammopathy of undetermined significance